Biocode: Resolution

By Terence McAdams

Multispectral signatures matching those of the Pleiades’ spacecraft have been detected on three different Pacific islands. Ciara and her friends journey to these locations only to discover that they are interconnected by a wormhole, serving as a portal to Earth’s twin planet.

However, this connection has become unstable, generating high-intensity gravity fields that result in space-time distortions. Ciara’s life is threatened when she is transported back in time to be captured by the Taniwha, a supernatural being from Māori mythology. Ciara’s visions of her ancestor, 18th-century naval officer William Hartley, shed light on her own predicament. However, Hartley has been wrongfully accused of murdering Royal Society artist, Elliot Loundes.

Unless the timeline can be restored, Ciara’s existence will come to an abrupt end. Can she and her friends outsmart the Taniwha, rescue her ancestor from the gallows, and stabilize the wormhole? The task will demand a sacrifice that few would be willing to make.

• Language: English
• Publisher: Austin Macauley Publishers
• Release date: Jan 5, 2024
• ISBN: 9781035845163

Terence McAdams

Terence McAdams’ books seek to educate with plot-twisting narratives interweaving science, technology and history. His writing focuses on positive role modelling through richly-drawn characters. His doctoral research focused on girls’ computer programming, and he advocates for girls in STEM. Terence also writes technical examination papers for the International Baccalaureate and publishes many articles on technology, data analysis and education. Terence seeks to enlighten and engage readers about scientific advancements through intrigue.

Book preview

About the Author

Terence McAdams’ books seek to educate with plot-twisting narratives interweaving science, technology and history. His writing focuses on positive role modelling through richly-drawn characters. His doctoral research focused on girls’ computer programming, and he advocates for girls in STEM. Terence also writes technical examination papers for the International Baccalaureate and publishes many articles on technology, data analysis and education. Terence seeks to enlighten and engage readers about scientific advancements through intrigue.

Dedication

To my wonderful students at North London Collegiate School and Branksome Hall Asia, getting to know you has provided much inspiration for my writing.

Copyright Information ©

Terence McAdams 2024

The right of Terence McAdams to be identified as author of this work has been asserted by the author in accordance with sections 77 and 78 of the Copyright, Designs and Patents Act 1988.

All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the prior permission of the publishers.

Any person who commits any unauthorised act in relation to this publication may be liable to criminal prosecution and civil claims for damages.

This is a work of fiction. Names, characters, businesses, places, events, locales, and incidents are either the products of the author’s imagination or used in a fictitious manner. Any resemblance to actual persons, living or dead, or actual events is purely coincidental.

A CIP catalogue record for this title is available from the British Library.

ISBN 9781035845156 (Paperback)

ISBN 9781035845163 (ePub e-book)

www.austinmacauley.co.uk

First Published 2024

Austin Macauley Publishers Ltd®

1 Canada Square

Canary Wharf

London

E14 5AA

Acknowledgment

Many thanks to Chrystene Rae for designing the cover artwork.

Many thanks to Juliet Kim for rewriting the Korean dialogue.

Many thanks to Faye Yang for rewriting the Chinese dialogue.

Many thanks to the pilot readers for their feedback.

Chapter 1

The Message

Awake but emotionally drained, Ciara Alinac couldn’t bring herself to get out of bed. She was still coming to terms with the death of James Fernley—the man who’d saved her life before betraying her. Although she’d only met him three months before, he was a father figure in a way Uncle John had never been. He’d made her feel special while offering emotional support she’d never experienced.

Tears welled in Ciara’s eyes, and she blinked, the salty water running down her cheeks. Then anger started bubbling up again. Fernley never cared about her. He’d used her to free his people, but in doing so, wheedled his way into her heart. She hated him for what had happened in the Pleiades boarding house. As quickly as it came, the anger was replaced by sorrow. Mr Fernley was dead, and she’d never see him again.

Ciara looked around the sparse dormitory room, wondering why she was still here and not back home in England. An almighty hammering on the bedroom door made her jump, startling her out of self-pity. She sat upright and rubbed a sleeve on her face to wipe the tears away.

Who is it? croaked Ciara.

The door flew open and four people burst into the tiny room. We need to save Mr Fernley from drowning, exclaimed Zixin.

Ciara had only just met these wonderful and extraordinary friends. Yet, she’d experienced more happiness with them over the last few weeks than at any point in her life. They’d travelled to New Zealand and Australia in search of the Patupaiarehe, a race of supernatural beings from Māori mythology. During that trip, they freed the Pleiades, an alien race intent on replacing humanity. They had uncovered many mysteries, but their adventures had resulted in several deaths.

Sophie solved the cypher, said Hana. It says—save James Fernley.

Hana was referring to an encrypted text message Ciara received after they’d stopped the Pleiades and shipped them to a small island off the coast of Jeju. The sender was unknown so they had no idea who it was from.

Ciara was still trying to process this information when Scottie spoke. My grandfather is convinced the Pleiades are not the Patupaiarehe. If we save Mr Fernley, he may know why these supernatural beings disappeared from New Zealand.

Sophie, who was the last to enter, accidentally slammed the door behind her. She cringed awkwardly and there was a brief pause.

Where’s Chan? Ciara’s voice was artificially flat with no trace of excitement.

He’s working with his voice coach…again, said Zixin, emphasising the last word. He’s stressing about performing at the Sydney Opera House.

Unused to being ignored, Hana raised her voice. Didn’t you hear what I said? The cypher says save—

I heard, interrupted Ciara.

Hana looked like she had been slapped. No one talked to her like that—except her father, maybe. Ciara could see her lips purse and waited for the angry response, but it didn’t come.

Why wouldn’t they leave her alone? The anger surged again. James Fernley tried to blind and enslave me, she shouted before quickly composing herself. Even if I could go back in time, I wouldn’t. He deserved to die. There was a coldness that had never been there before.

But what if the Pleiades were controlling him? suggested Hana. My father said that he felt diminished when they took over his mind. He knew what was happening but couldn’t stop it.

Ciara balled her hands up into fists and watched her knuckles turn white. He was one of them. Each word was emphasised. I saw him force Moody to throw his cutlass off the cliff.

We’re not saying he wasn’t one of them, said Zixin in a mollifying voice. But he was separated from them for over two hundred years, and maybe he developed some humanity during that time.

Ciara was struggling to control her temper. He didn’t show much humanity in the end.

I met with Mr Fernley several times, interjected Sophie. I wouldn’t have survived at this school without him. He cared about us. If he changed, it was because they made him change.

Arrrrggggghhh! exclaimed Ciara. It was an act. He died, and that’s that.

Zixin looked at Hana expectantly, but there was no reaction, so she said, Ciara, do you remember when you changed William Hartley’s future?

There was no response so she continued. He’d failed to rescue his friend from the Māori fort and was about to be flogged. Then you went back into the vision and were able to redo your actions, getting it right on the second attempt.

Zixin was suggesting that Ciara had changed the past. She had wondered about that, but deep down, she knew someone else had been controlling events, and she was just along for the ride.

I’m not sure why that vision altered, said Ciara. I think I was being shown it was possible. Perhaps so I would learn something.

That suggests you might be able to change the past, said Zixin. Why else would they train you?

Even if I could change time, which I can’t, said Ciara. Fernley died in our present while William Hartley lived in the 18th century. The two events are entirely different, and even if they weren’t, why would I save Fernley from drowning?

Scottie’s shoulders slumped. Then we’ll never know what happened to the Patupaiarehe.

Ciara’s heart wasn’t in this adventure anymore. Still, she could see how much this meant to her friends and didn’t want to alienate them. In a conciliatory gesture, she said, The person who sent the text message probably knows something. Although we have no idea who that was, they might message again. Until then, there’s nothing we can do.

Without saying a word, Scottie walked out of the room. Hana and Zixin followed, but Sophie hung back. After a brief pause, she said, It might not mean saving him now. You might need to save him in the past. In your last dream, Mr Fernley saved William Hartley’s life, right? Maybe William Hartley needs to save him at an earlier time. And if you don’t, you might never be born.

Fernley had saved William Hartley’s life. She was a direct descendent of Hartley, making him her great-great-great-grandfather or something like that. Was her life in danger again? Did it matter if she ceased to exist? She wouldn’t know anything about it. Strangely, that made her feel a little better.

I’m sorry for reacting like I did, said Ciara. I just felt so betrayed by him.

I know what you mean, said Sophie. He was my favourite teacher before everything…

The other three students were still outside the open door. Zixin popped her head back in and said, We’re going to the cafe, Ciara. Come with us, and brainbox here can show you how she solved the cypher.

The beautifully designed cafe was in the main building. On one side were massive glass panels that looked out to palm trees, giant leafy ferns, and rose bushes. On the other side was a two-metre square clock that showed the time in Hangul. Some students had built it using Arduino computers, and a different square lit up every second.

They ordered their drinks and sat at a large oak table. The top was roughly ten centimetres thick, while the edges retained the tree’s shape. Sophie pulled out a tablet from her bag and displayed the message on the screen.

’AGGTTTACGACGTACGTAGGTTTTACGACCGTACGTCCCCCGTACACGTACGTAATTTACG

TAACCGTACGTAGGTTTACGGGTACGTACACCGTACGTGGTTTACGTGGTTACGTATTTACG

TACACCGTACGTATTTTTTAC’

This is quite a simple cypher, said Sophie. I’m not sure why they bothered to encrypt it.

Maybe to make it seem important? suggested Scottie.

Anyway, said Sophie. There are only four letters used—A, C, G, and T. Each represents the four nucleotides—adenine, cytosine, guanine, and thymine. These are the building blocks for DNA. Under normal circumstances, the nitrogen-controlling bases adenine and thymine pair together and—

Oh my God! exclaimed Zixin. Explain the code, Sophie. Nobody wants a biology lesson.

Sorry, said Sophie looking down at the table to avoid eye contact. The code doesn’t make any biological sense, so I looked for repeating patterns, and there are several.

Hana frowned. Why did you look for repeating patterns?

Sophie hadn’t explained how she’d solved the code to the others, so they were listening intently.

Because certain letters appear more frequently in the Latin alphabet than others. E, for example, appears more often than any other letter.

This is still taking too long, Sophie, said Zixin.

I found that the sequence is made up of nine characters. Sophie showed them the message split up.

‘AGGTTTACG ACGTACGTA GGTTTTACG ACCGTACGT CCCCCGTAC ACGTACGTA ATTTACGTA ACCGTACGT AGGTTTACG GGTACGTAC ACCGTACGT GGTTTACGT GGTTACGTA TTTACGTAC ACCGTACGT ATTTTTTAC’

Notice that each segment starts with an A or duplicate letters. The A is one point, C is two, G is three, and T is four.

The others craned forward to see what Sophie was showing them. So the first segment is worth twenty-five points, said Ciara.

No, but I can see why you would think that.

So help me, Sophie, said Zixin. If you don’t tell us directly, I will strangle you.

Speaking more quickly, Sophie blurted out, You only count the numbers up to the end of the duplicated sequence. AGGTTT is nineteen, and S is the nineteenth letter in the alphabet.

Ohhh, said Ciara. The second segment has no duplicated sequence, so you just count A, which is one, and A is the first letter in the alphabet.

Zixin snatched the tablet from Sophie. My turn, she said. GGTTTT is six and twenty-four, so thirty, which is…not a letter.

Sophie tried to take back her tablet but Zixin pulled it away. Wait! I multiplied four by six instead of four by four. So, sixteen plus six is twenty-two, and V is the twenty-second letter in the alphabet.

Zixin looked so pleased with herself that Ciara gave a little laugh. The Chinese girl glared at her. If you’re making fun of me, Alinac—

I’m not, honestly, said Ciara. I was just thinking how funny it would be if the person writing this message miscalculated it. We’d never know what it said.

Scottie leaned over and whispered in Ciara’s ear, You dodged a bullet there.

I know, right, whispered Ciara.

Zixin glared at them both but said nothing. Next to her, Hana looked less than impressed with the intimacy between Scottie and Ciara. Fortunately, Sophie interjected. So you see, the message says—save James Fernley.

Scottie turned to Hana. Did you have any luck tracing the message?

It was impossible to trace, said Hana. The telecom company said it was an untraceable burner phone hidden inside a Faraday pouch except when the message was sent. The message was scrambled and redirected around the globe.

It doesn’t matter who sent the message, said Ciara. It’s too late to save him, even if we wanted to. Sensing the others’ disapproval, she hastily added. We should continue to search for the Patupaiarehe, and then maybe this will make sense.

Hana folded her arms across her chest. How do suggest we do that?

We could start by seeing whether Mr Fernley drowned, suggested Sophie. Can we look for his body?

Really, Soph? said Scottie. I don’t fancy coming across a bloated corpse while scuba diving.

At least, we should find out where he fell in, said Sophie.

Ciara could tell that Sophie couldn’t move on without a body to prove Mr Fernley had died. Without her usual empathy, she asked, Why does it matter?

Somebody sent that message for a reason, said Sophie. We don’t know what information is useful at this stage. We must gather as much data as possible before trying to make sense of it.

I have a film clip of where Fernley fell in, said Hana. One of my father’s team videoed their search for him. The longitude and latitude will be embedded in the file.

Suddenly, Zixin leapt out of her chair and stood to attention. She stopped short of saluting as a Chinese man of medium height walked up to their table. He was around 40 years of age, had a military bearing and looked fit.

欢迎父亲 (Huānyíng fùqīn), said Zixin.

Ciara guessed that the man was Zixin’s father by her reaction. 离开我们 (Líkāi wǒmen), he barked.

Zixin gave Ciara a look of apology and grabbed Hana by the arm. We should go. My father wants to talk to Ciara. Hana and Sophie got up and immediately followed Zixin. Defiantly, Scottie stayed seated.

It’s okay, said Ciara, smiling at Scottie. He shrugged, slid his chair back, and, taking his time, ambled after the others.

Instead of feeling intimidated, which would be the normal reaction to this man, Ciara felt disdain. Seeing how subservient her friend was in his presence sickened her. He may be a high-powered Chinese dignitary, but as a father, he sucked. That much was obvious.

Ciara stayed seated and glared at him. If Mr Yang expected her to stand up, he never reacted. He sat in the chair opposite and said, So you’re the girl who broke into our lab and stole a vial of smallpox.

Ciara had expected a Chinese accent, but the man had a cultured English inflection. His voice was masterful. You wanted him to talk to hear the melody, which was almost musical with its slightly singsong rhythm.

And you’re the man who had me kidnapped and taken to a lab for experimentation, said Ciara.

The tension disappeared the moment Mr Yang laughed. There was a sparkle in his eyes. I have been looking forward to meeting you, Ciara. And you don’t disappoint. He stood up and smiled. Let me get you a drink. What would you like?

Chocolat chaud, s’il vous plaît, she said.

The menu was in French, so she’d used that language to catch Mr Yang off guard. It didn’t work. The man headed straight to the counter, ordered two hot chocolates and returned a few minutes later. He sat down again and asked, Do you mind if I ask you a few questions, Ms Alinac?

He was so charming, she couldn’t refuse his request. Besides, she had broken into his lab, stabbed the director with a scalpel, injected a neuroscientist with succinylcholine, and stolen a vial of smallpox.

Not at all.

Mr Yang pulled out his phone, and Ciara thought he would record their conversation. Instead, he opened up a surveillance video and played it. The recording angle indicated the camera was on the ceiling of the neuroscience lab in Harbin.

Ciara could see herself strapped down in a chair and Dr Wang crouching over her, a syringe in his hand. She remembered almost blacking out before finding herself free. Now she was going to see what had happened and leaned forward with interest.

On the small screen, Ciara could just make out the frequency line on the EEG machine was oscillating frantically. Dr Wang jerkily reached out and grasped a scalpel from a kidney bowl. He bent forward, cut the straps binding Ciara’s arms, and stood up.

The waitress walked over, carrying the drinks on a tray. Mr Yang stopped the recording and thanked the waitress in Korean. Once she was out of earshot, he said, Would you mind explaining how you did that?

Ciara took a sip of the hot chocolate. It was delicious but burned her lip a little. Dr Wang felt sorry for me and decided to help me escape.

Mr Yang ignored her flippant remark. I know that until recently, this school was the home of an alien race who could impose their will over others. They now reside at Sanjung’s research institute on Geumdo Island.

It was strange hearing Dr Kim’s first name being used. Everyone referred to him by his surname and the honorific, doctor, out of deference. Clearly, the relationship between Zixin’s and Hana’s fathers was on an equal footing.

If you’re here because of the smallpox virus, I never intended to use it, said Ciara. It’s still on Dr Kim’s jet, in the freezer part of a small fridge.

That’s not why I’m here. The vial has already been retrieved and returned to the lab in Harbin.

Mr Yang took a sip of his hot chocolate. Mmmm, it’s good! I ordered it with soya milk. Much better for you.

Ciara wanted to say that soya was high in oestrogen and unhealthy for a man his age. Instead, different words came out. No, that’s fine, thank you.

Mr Yang’s interrogation technique was intriguing. He’d given her irrefutable evidence of her mind control abilities, demonstrated he knew everything, and then talked about soya milk. She guessed he was about to get to the point of his visit.

We think we’ve detected more UFOs. Or at least objects with the same multispectral signature as the ship in New Zealand. Strangely, there is deadness immediately after we detect an energy surge. Since you seem immune to the Pleiades… He paused momentarily to search for the right word, Abilities, we thought you might like to help us.

Ciara’s stomach lurched. She wasn’t going through an ordeal like the last one. As her pre-frontal cortex took over from her limbic brain, she realised that the ship inside Pirongia Mountain would not have an energy signature. It was too deep inside dense rock formations. Unless Dr Kim had detected the energy signature after he was allowed into the mountain. Which would mean he was working with the Chinese government.

And if I refuse?

I understand that you and my daughter have become close. It would be a shame if she were to return to China with me.

Mr Yang had honed in on Ciara’s weakness. She cared more about her friends at Sanjung Academy than anyone else. Losing Zixin would be an emotional blow.

With respect, Mr Yang, you’re bluffing. You need Zixin to keep an eye on things here.

The Chinese diplomat didn’t react. No change in his facial expression whatsoever. He took a swig of his hot chocolate. Very well, Miss Alinac. It appears our conversation is over. Sliding his chair back, he stood up.

Ciara’s bluff was called, so she proposed a compromise. Suppose you share your intel with me, and I work with my friends to unravel this mystery. In exchange, Zixin will give you regular updates.

Mr Yang’s handsome face became ugly as it contorted. She didn’t do a very good job updating me before.

Ciara flinched, feeling guilty that she’d not considered her friend’s sacrifice. Mr Yang would have seen video footage of his daughter entering the Harbin Research Institute and leaving with Ciara. What punishment had he inflicted on Zixin?

Mr Yang’s face smoothed back to its distinguished, composed state. There is, however, a problem with our intelligence. We cannot pinpoint the origin of the signal.

So you want me to look for more alien ships but you don’t know where to find them? I don’t think—

We detect a signature at one location, then a deadness follows. The signature then appears thousands of kilometres away. Maybe our readings are imprecise or perhaps there are multiple signals. For all we know, their ship might fly at incredible speeds.

Why are you telling me this? I’m not remotely qualified to solve this mystery. Nor do I have the resources.

Mr Yang frowned as if realising how ridiculous this situation was. With all the power of the Chinese government at his disposal, he’d just asked a 16-year-old girl to track down a UFO. The facial tension only lasted a moment.

He chuckled. I would have said the same a couple of months ago. I’ll send the intel to Zixin. Without another word, he walked off.

Ciara pushed the hot chocolate away and watched one of the most powerful men in China walk away. Once he was out of sight, the others returned to their seats.

Zixin was the first to speak. What did he want?

Ciara hugged Zixin, feeling her attempt to pull away, before giving up.

Without letting her friend go, Ciara asked, Aren’t you going to talk to your father before he leaves?

Untangling herself from the hug,